Mature sequence bmo-miR-2752

Accession numberMIMAT0012632
IDbmo-miR-2752
Stem-Loop bmo-mir-2752
Sequence
cucaacacgauggccacgga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).