Mature sequence bmo-miR-9c-3p

Accession numberMIMAT0012621
IDbmo-miR-9c-3p
Previous IDsbmo-miR-9c
Sequence
uaaaguuaugguaccgaaguua
Get sequence
Stem-Loop bmo-mir-9c

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).