Mature sequence aqc-miR171c

Accession numberMIMAT0012568
IDaqc-miR171c
Stem-Loop aqc-MIR171c
Sequence
uaauugaaccgcacuaauauc
Get sequence
Deep sequencing reads, experiments

References

1