Mature sequence aqc-miR171f

Accession numberMIMAT0012565
IDaqc-miR171f
Stem-Loop aqc-MIR171f
Sequence
uaauugagccgugccaauauc
Get sequence
Deep sequencing reads, experiments

References

1