Mature sequence aqc-miR166d

Accession numberMIMAT0012559
IDaqc-miR166d
Stem-Loop aqc-MIR166d
Sequence
ucggaccaggcuucauuccuc
Get sequence
Deep sequencing reads, experiments

References

1