Mature sequence aqc-miR166c

Accession numberMIMAT0012558
IDaqc-miR166c
Stem-Loop aqc-MIR166c
Sequence
ucggaccaggcuucauuccu
Get sequence
Deep sequencing reads, experiments

References

1