Mature sequence aqc-miR166b

Accession numberMIMAT0012557
IDaqc-miR166b
Stem-Loop aqc-MIR166b
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1