Mature sequence aqc-miR166a

Accession numberMIMAT0012556
IDaqc-miR166a
Stem-Loop aqc-MIR166a
Sequence
ucggaccaggcuucauuccuc
Get sequence
Deep sequencing reads, experiments

References

1