Mature sequence aqc-miR166e

Accession numberMIMAT0012555
IDaqc-miR166e
Stem-Loop aqc-MIR166e
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1