Mature sequence mdv2-miR-M23-3p

Accession numberMIMAT0012542
IDmdv2-miR-M23-3p
Previous IDsmdv2-miR-M23*
Stem-Loop mdv2-mir-M23
Sequence
gucuccguacaccggaccaucg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17459919 "Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Sewer A, Zavolan M, Nair V J Virol. 81:7164-7170(2007).
2
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).