Mature sequence dps-miR-988-5p

Accession numberMIMAT0012233
IDdps-miR-988-5p
Previous IDsdps-miR-988*
Stem-Loop dps-mir-988
Sequence
gugugauuuguggcaaagugau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).