Mature sequence dme-miR-2493-5p

Accession numberMIMAT0012200
IDdme-miR-2493-5p
Previous IDsdme-miR-2493*
Stem-Loop dme-mir-2493
Sequence
gcucacacacacacacagcca
Get sequence
Deep sequencing21 reads, 13 experiments
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).