Mature sequence ath-miR1886.2

Accession numberMIMAT0012129
IDath-miR1886.2
Stem-Loop ath-MIR1886
Sequence
ugagaugaaaucuuugauugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends" German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ Nat Biotechnol. 26:941-946(2008).
2
PMID:19307293 "Computational and analytical framework for small RNA profiling by high-throughput sequencing" Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC RNA. 15:992-1002(2009).