Mature sequence bta-miR-449d

Accession numberMIMAT0011962
IDbta-miR-449d
Stem-Loop bta-mir-449d
Sequence
gaaggcugugugcuguggag
Get sequence
Deep sequencing18 reads, 5 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).