Mature sequence bta-miR-2320-3p

Accession numberMIMAT0011845
IDbta-miR-2320-3p
Previous IDsbta-miR-2320*
Stem-Loop bta-mir-2320
Sequence
ucgaugauggucccuguguuuu
Get sequence
Deep sequencing111 reads, 52 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).