Mature sequence hsa-miR-2278

Accession numberMIMAT0011778
IDhsa-miR-2278
Stem-Loop hsa-mir-2278
Sequence
gagagcaguguguguugccugg
Get sequence
Deep sequencing618 reads, 79 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).