Mature sequence hsa-miR-2277-3p

Accession numberMIMAT0011777
IDhsa-miR-2277-3p
Previous IDshsa-miR-2277
Stem-Loop hsa-mir-2277
Sequence
ugacagcgcccugccuggcuc
Get sequence
Deep sequencing384 reads, 93 experiments
Predicted targets

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).