Mature sequence zma-miR2275b-3p

Accession numberMIMAT0011770
IDzma-miR2275b-3p
Stem-Loop zma-MIR2275b
Sequence
uucaguuuccucuaauaucuca
Get sequence
Deep sequencing3 reads, 1 experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).