Mature sequence zma-miR2275b-5p

Accession numberMIMAT0011769
IDzma-miR2275b-5p
Stem-Loop zma-MIR2275b
Sequence
aggauuagaggcaacugaacc
Get sequence
Deep sequencing155 reads, 119 experiments
Database links
QuickGO function

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).