Mature sequence osa-miR2275b

Accession numberMIMAT0011759
IDosa-miR2275b
Stem-Loop osa-MIR2275b
Sequence
uuugguuuccuccaauaucuca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).