Mature sequence osa-miR2118b

Accession numberMIMAT0011741
IDosa-miR2118b
Stem-Loop osa-MIR2118b
Sequence
uucccgaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).