Mature sequence cbr-miR-74b-5p

Accession numberMIMAT0011501
IDcbr-miR-74b-5p
Previous IDscbr-miR-74b*
Stem-Loop cbr-mir-74b
Sequence
uggacuuccuucucguucccagc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).