Mature sequence cel-miR-2220-3p

Accession numberMIMAT0011462
IDcel-miR-2220-3p
Previous IDscel-miR-2220
Stem-Loop cel-mir-2220
Sequence
ucaauuguuuguggacuuacag
Get sequence
Deep sequencing372 reads, 14 experiments
Database links
Predicted targets
QuickGO function

References

1