Mature sequence cel-miR-2209b-3p

Accession numberMIMAT0011454
IDcel-miR-2209b-3p
Previous IDscel-miR-2209b
Stem-Loop cel-mir-2209b
Sequence
agagaugagcgguugugcuuca
Get sequence
Deep sequencing63 reads, 7 experiments
Predicted targets

References

1