Mature sequence sbi-miR821a

Accession numberMIMAT0011385
IDsbi-miR821a
Stem-Loop sbi-MIR821a
Sequence
aagucaucaacauaaaaguug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).