Mature sequence sbi-miR166k

Accession numberMIMAT0011330
IDsbi-miR166k
Stem-Loop sbi-MIR166k
Sequence
ucggaccaggcuucauuccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).