Mature sequence dre-miR-2188-3p

Accession numberMIMAT0011310
IDdre-miR-2188-3p
Previous IDsdre-miR-2188*
Stem-Loop dre-mir-2188
Sequence
cugugugagguuagaccuauc
Get sequence
Deep sequencing1983 reads, 10 experiments
Database links
QuickGO function

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).