Mature sequence dre-miR-2191

Accession numberMIMAT0011300
IDdre-miR-2191
Stem-Loop dre-mir-2191
Sequence
ucacaccuacaaucccuggca
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).