Mature sequence dre-miR-1788-5p

Accession numberMIMAT0011294
IDdre-miR-1788-5p
Previous IDsdre-miR-1788
Stem-Loop dre-mir-1788
Sequence
ggcuuguuuuaaguugccugcg
Get sequence
Deep sequencing13 reads, 6 experiments
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).