Mature sequence dre-miR-429b

Accession numberMIMAT0011291
IDdre-miR-429b
Stem-Loop dre-mir-429b
Sequence
uaauacugccugguaaugccau
Get sequence
Deep sequencing29197 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).