Mature sequence sme-miR-2167

Accession numberMIMAT0011264
IDsme-miR-2167
Stem-Loop sme-mir-2167
Sequence
uguguuaagcuggucuuucaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).