Mature sequence osa-miR2121a

Accession numberMIMAT0011180
IDosa-miR2121a
Stem-Loop osa-MIR2121a
Sequence
aaaacggagcgguccauuagcgcg
Get sequence
Deep sequencing441 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19081140 "Heavy metal-regulated new microRNAs from rice" Huang SQ, Peng J, Qiu CX, Yang ZM J Inorg Biochem. 103:282-287(2009).