Mature sequence pvu-miR166a

Accession numberMIMAT0011175
IDpvu-miR166a
Stem-Loop pvu-MIR166a
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).