Mature sequence hsa-miR-2117

Accession numberMIMAT0011162
IDhsa-miR-2117
Stem-Loop hsa-mir-2117
Sequence
uguucucuuugccaaggacag
Get sequence
Deep sequencing15 reads, 11 experiments
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).