Mature sequence xla-miR-15c

Accession numberMIMAT0011140
IDxla-miR-15c
Stem-Loop xla-mir-15c
Sequence
uagcagcacaucaugguuugua
Get sequence
Deep sequencing reads, experiments

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).