Mature sequence mtr-miR171g

Accession numberMIMAT0011121
IDmtr-miR171g
Stem-Loop mtr-MIR171g
Sequence
uugauugagccgugccaauau
Get sequence
Deep sequencing reads, experiments

References