Mature sequence mtr-miR166h

Accession numberMIMAT0011114
IDmtr-miR166h
Stem-Loop mtr-MIR166h
Sequence
cucggaccaggcuucauuccc
Get sequence
Deep sequencing reads, experiments

References