Mature sequence mtr-miR171f

Accession numberMIMAT0011113
IDmtr-miR171f
Stem-Loop mtr-MIR171f
Sequence
uugagccgugccaauaucacg
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).