Mature sequence mtr-miR399n

Accession numberMIMAT0011095
IDmtr-miR399n
Stem-Loop mtr-MIR399n
Sequence
ugccaaaggagagcugcccua
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).