Mature sequence mtr-miR399m

Accession numberMIMAT0011094
IDmtr-miR399m
Stem-Loop mtr-MIR399m
Sequence
ugccaaaggagagcugcccua
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).