Mature sequence mtr-miR398b

Accession numberMIMAT0011088
IDmtr-miR398b
Stem-Loop mtr-MIR398b
Sequence
uguguucucaggucgccccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).