Mature sequence mtr-miR399k

Accession numberMIMAT0011078
IDmtr-miR399k
Stem-Loop mtr-MIR399k
Sequence
ugccaaagaagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).