Mature sequence mtr-miR399i

Accession numberMIMAT0011076
IDmtr-miR399i
Stem-Loop mtr-MIR399i
Sequence
ugccaaaggagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).