Mature sequence mtr-miR399h

Accession numberMIMAT0011075
IDmtr-miR399h
Stem-Loop mtr-MIR399h
Sequence
ugccaaaggagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).