Mature sequence mtr-miR166d

Accession numberMIMAT0011068
IDmtr-miR166d
Stem-Loop mtr-MIR166d
Sequence
ucgggccaggcuucauccccc
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).