Mature sequence hsa-miR-759

Accession numberMIMAT0010497
IDhsa-miR-759
Stem-Loop hsa-mir-759
Sequence
gcagagugcaaacaauuuugac
Get sequence
Deep sequencing10 reads, 8 experiments
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).