Mature sequence ssc-miR-215

Accession numberMIMAT0010192
IDssc-miR-215
Stem-Loop ssc-mir-215
Sequence
augaccuaugaauugacagac
Get sequence
Deep sequencing9 reads, 5 experiments

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).