Mature sequence bra-miR172b-3p

Accession numberMIMAT0010168
IDbra-miR172b-3p
Previous IDsbra-miR172b
Stem-Loop bra-MIR172b
Sequence
agaaucuugaugaugcugcau
Get sequence
Deep sequencing reads, experiments

References

1