Mature sequence bra-miR172b-5p

Accession numberMIMAT0010167
IDbra-miR172b-5p
Previous IDsbra-miR172b*
Stem-Loop bra-MIR172b
Sequence
gcagcaccauuaagauucaca
Get sequence
Deep sequencing reads, experiments

References

1