Mature sequence bra-miR172a

Accession numberMIMAT0010166
IDbra-miR172a
Stem-Loop bra-MIR172a
Sequence
agaaucuugaugaugcugcau
Get sequence
Deep sequencing reads, experiments

References

1
2